Is het mogelijk om een bepaald diersoort ( bv. muggen) uit te roeien dmv een specifieke, op dna gebaseerde dodelijke ziekte?

Een door de mens gemaakte dodelijke ziekte die alleen het betreffende diersoort kan krijgen.

Weet jij het antwoord?


Het beste antwoord

Natuurlijk kan dat niet, want die op DNA gebaseerde dodelijke ziekte, zal zich, zoals alle op DNA gebaseerde levensvormen, gaan muteren om zich aan te passen aan de nieuwe omstandigheden. Als de muggen er aan zijn, gaan ze op zoek naar een nieuwe gastheer, en niemand kan voorspellen wat er dan gebeurt.... Bovendien kan ook niemand je precies vertellen welke dominosteen in de lange lange rij de mug precies is, en wat de gevolgen zijn van het uitroeien van een misschien wel heel cruciale schakel in de keten. Alleen maar omdat wij het prikken lastig vinden een hele schakel uit die keten weg willen halen, lijkt me wel heel erg kortzichtig. Het is dus niet mogelijk. Niet in theorie, want je weet niet welke diersoorten je meeneemt in je kielzog, en niet in de praktijk, want je zou er werkelijk de hele wereld voor moeten vergiftigen. Daarbij zijn er ongetwijfeld een paar muggen resistent tegen WAT je ook in hun milieu brengt, en wordt de ellende daarna vermoedelijk alleen nog maar groter. Afblijven dus, en gewoon een hor voor je ramen zetten. Vele malen effectiever, en ook beduidend beter voor het milieu. Ik weet niet meer wie het hier laatst zei, maar het is hier wel heel erg toepasselijk : don't fuck with nature !

Nee hoor dat gaat niet... Ze hebben konijnen willen uitroeien in Australië met Myxomatose, lukte ook niet... Dat gaat niet, helaas...

Ja, maar zoals je het voorstelt is het niet handig. Hoe besmet je alle muggen? Tijdens het kruisen zouden de kindjes dan namelijk doodgaan, dus er treedt geen sneeuwbal-effect op. Het omgekeerde werkt beter. Er wordt momenteel geexperimenteerd met het uitroeien van de malariamug door een mutant te kweken die juist *sterker* is (en op termijn de normale malariamug zal verdringen) en die de mens niet kan besmetten.

Muggen zijn voedsel voor vogels op hun beurt, dus nogal ingrijpend. En waar houdt het op dan, gaan we alle tijgers dan ook afschieten, die pakken ook af en toe een mens. Antwoord: Het zou vast kunnen, maar niet echt zinnig.

Ha, die Chx; Er is op dit gebied al vaak genoeg geëxperimenteerd met beperkt succes. Maar wie bepaalt er welke diersoorten er voor vernietiging in aanmerking komen? Er bestaat ook nog zoiets als de voedslkring waarvan wij allemaal deel uitmaken.

Het natuurlijke evenwicht is door ons menselijke ingrijpen al enorm verstoord, en dat raakt hoe langer hoe meer in een stroomversnelling. Als je één stukje van de legpuzzel weghaalt, dondert de hele boel in elkaar, omdat er steeds sprake is van onderlinge afhankelijkheid. Bovendien is de natuur zo vindingrijk, dat soorten resisitent worden tegen bestrijdingsmiddelen. Een soort uit laten sterven kunnen we wel, door ze óf uit te moorden, (zoals dreigt te gebeuren bij de siberische tijger en een aantal walvissoorten waar er nog maar zó weinig van zijn, dat ze geen soortgenoot meer kunnen vinden om zich mee voort te planten) of hun habitat dermate te verstoren, dat ze niet meer kunnen overleven. (dit lot wacht bijv de cheeta) Maar een ziekte introduceren waarbij alleen één bepaalde soort uitsterft, gaat niet - je sleurt onwillekeurig andere soorten mee. Éen diersoort kan de mens wél met een dodelijke ziekte uitmoorden : wordt wel eens gesproken over een wereldoorlog, die door één grote mogendheid ontketend zou kunnen worden door het verspreiden van zo'n besmettelijke dodelijke ziekte. Die virussen zijn er, maar wij, als leken, weten niet wie ze allemaal in voorraad hebben misschien maar goed ook, toch?

Zoals ik al eens eerder geantwoord hebt op een vraag, of antwoord. Je wilt een poot wegzagen en dan er vanuit kunnen gaan dat de tafel blijft staan... En zoals al eerder gezegd. Hoe wil je in 1 keer alle muggen kunnen bereiken? Maar los hiervan blijft het natuurlijk altijd mogelijk om op basis van DNA vergiftiging een diersoort uit te roeien. Probleem is alleen dat we nog te weinig van al het DNA weten...

Nee dat kan niet. Het mooie van DNA is de variatie. Het hele idee van het darwinistische model van evolutie is dat niemand -behalve een-eiige tweelingen- gelijk is. Dus op elk nivo zit er verschil tussen dieren. Dat geld voor het verschil tussen schildpadden en ratten maar ook tussen de ene mug en de andere mug. Zie DNA als een lange keten van zichzelf herhalende stukjes eiwit. Er zijn maar 4 verschillende stukjes eiwit die de hele keten opmaken, welke vervolgens miljoenen malen achter elkaar geplakt zijn. Dit is de code die de opbouw van leven bepaald. Een strukje streng ziet er dan bv uit als aaaatcggatttattagggccc, waarbij de a,c,g, en t staan voor de verschillende eiwitten. Door een ziekte te maken die op een bepaald deel van het DNA aangrijpt, zal je wellicht 99,9% van de muggen kunnen doden, die allemaal een bepaalde serie van de A,C,G en T hebben. Echter, er blijft dan 0.1% van de muggen over, welke die volgorde niet heeft, of waarvan de groep net iets anders is. Die gaan zich vervolgens voortplanten, en binnen enkele generaties zie je dat het grootste deel van de muggen resistent is. Tevens: Als je zo'n zioekte maakt, is het onmogelijk van tevoren vast te stellen welke andere dieren er ook last van gaan krijgen: Mara je de serie eiwitten die nodig is om de ziekte te activeren te kort dan bereik je veel te veel dieren. Maak je de streng te lang, dan bereik je veel te weinnig muggen. Daarnaast is het zowieso de vraag waarom je een diersoort zou willen uitroeien, maar dat is een compleet andere vraag.

Stel zelf een vraag

Ben je op zoek naar het antwoord op die ene vraag die je misschien al tijden achtervolgt?
